Molecular characterization of an H1N2 swine influenza virus isolated in Miyazaki, Japan, in 2006

Swine influenza virus (SIV) was isolated from a farm in Miyazaki Prefecture in Japan in July 2006. An isolate was genetically subtyped as H1N2 and was designated A/swine/Miyazaki/1/2006 (H1N2). The nucleotide sequences of all eight viral RNA segments were determined, and then phylogenetic analysis was performed using the neighbor-joining method. All segments were shown to be closely related to those of Japanese SIV H1N2 isolates, which have been circulating since the 1980s. The results indicate the persistence of the SIV H1N2 subtype in the Japanese pig population for more than two decades and emphasize the importance of continuous surveillance for SIV.     

N-acetylglucosaminyltransferase I activity of bovine oviduct epithelial cells: stimulation by luteinizing hormone, vascular endothelial growth factor and tumor necrosis factor alpha

N-acetylglucosaminyltransferase I (GnT I; EC 2.4.1.101), which catalyzes the first step in the conversion of oligomannose to complex or hybrid N-glycans of glycoproteins, was found in media cultured with bovine oviduct epithelial cells (BOEC) obtained from non-pregnant cows during the follicular phase. Combined treatment with specific hormones increased GnT I release from BOEC. Luteinizing hormone (LH; 10 ng/ml) alone slightly, but together with 17beta-estradiol (E2; 1 ng/ml), synergistically increased GnT I activity. Vascular endothelial growth factor (VEGF) and tumor necrosis factor (TNF) alpha, which have been shown to have their highest activities in the bovine oviduct during the periovulatory period, also increased in GnT I activity. This study provides the first evidence of an increase of GnT I release from BOEC in vitro, and shows that endocrine as well as local factors such as LH, VEGF and TNFalpha increase this activity. The results suggest that GnT I activity in the bovine oviduct may contribute to the induction of glycosylation and thereby contributing to the provision of the optimal microenvironment for fertilization and early development of the embryos.     

A case of anaplastic meningioma in a dog

A tumor sized in 2.0x2.0x2.5 cm developed in the cerebellum of a female Beagle was pathologically investigated. Histopathologically, the tumor grew by compression and partially by infiltration into the adjacent cerebellar parenchyma. There were a large number of necrotic lesions and proliferation of collagen fibers. The tumor cells had oval nucleus showing cellular atypia and a high mitotic index. The tumor cells were reacted with vimentin antibody on immunostain. Electron microscopic examination revealed the tumor cells interdigitated with cytoplasmic processus where the desmosomes developed on cell junction. This tumor was diagnosed as anaplastic meningioma, which is rarely observed in dogs.     

Mitochondrial DNA analysis of Nepalese domestic dwarf cattle Lulu*

Dwarf Lulu cattle, the only Bos Taurus type of cattle in Nepal, are raised under severe environments in the mountainous zone of that country. In the present study, the body measurement traits, cytogenetic and molecular genetic characteristics of the Lulu cattle are investigated. Blood samples were collected from 31 animals in four villages (altitudes 2590–3550 m) in the southern part of Mustang. The Lulu cattle had a normal karyotype with 2n = 60, XY or XX. Only one male examined had a large submetacentric X‐chromosome and a small submetacentric taurine type Y‐chromosome. The mitochodrial DNA (mtDNA) genotypes were analyzed by PCR mediated restriction fragment length polymorphisms, displacement (D)‐loop region PCR mediated single strand conformation polymorphisms, and D‐loop region sequences. Many base substitutions were found in the D‐loop region, suggesting that the Lulu cattle originated from at least 10 maternal lines. Three types of mtDNA from these cattle were found, the Bos taurus type (n = 23), the Bos indicus type (n = 6), and the Bos grunniens type (n = 2). In the village at the lowest altitude, four of the five cows were of the Bos indicus type. These results indicated that mtDNA types of the Lulu cattle mostly belong to Bos taurus, but have been hybridized with Bos indicus cattle in lower‐elevation regions in their maternal lineage.     

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.     

Effects of whey protein hydrolysate on growth promotion and immunomodulation in mouse pups in artificial rearing system

This study aimed to investigate the effects of whey protein hydrolysate (WPH) on the growth and immunity of mouse pups in artificial rearing (AR) system. Mouse pups were reared in the AR system with artificial milk including 5% WPH (AR with WPH) or not (AR without WPH), and the remaining pups were reared by their mother (dam) for 14 days after birth. The body weight change and body weight gain rates in the AR with WPH group were significantly higher than those observed in the AR without WPH group and similar to those in the dam group. Moreover the feed and protein efficiencies in the AR with WPH group were significantly higher than those of the AR without WPH group. In addition, the supplement of WPH in the AR system was shown to significantly elevate the number of CD3⁺CD8⁺, B220⁺CD19⁺, IA/IE⁺CD11c⁺, and CD11b⁺ in the thymocyte and/or splenocyte, and the thymus weight. Furthermore, MALDI‐TOF/MS analysis identified the amino acid sequences corresponding to some peptides, and indicated that VRTPEVDDE had the highest relative intensity among the peptides from tested WPH. Therefore, WPH would be required to not only promote growth, but also exert immunomodulatory activities in mouse pups in AR system.     

Effects of apple pomace‐mixed silage on growth performance and meat quality in finishing pigs

We measured the growth performance and meat quality of 10 crossbred (Yorkshire × Duroc × Landrace) neutered male pigs to evaluate the effects of apple pomace‐mixed silage (APMS). The pigs were divided into two groups and were respectively fed the control feed and the AMPS ad libitum during the experiment. No difference was found in the finished body weight, average daily gain, carcass weight, back fat thickness or dressing ratio between the control and the AMPS treatments, but average dairy feed intake (dry matter) was significantly lower and feed efficiency was significantly higher using the APMS treatment (P < 0.05). With regard to meat quality, the APMS increased the moisture content but decreased the water holding capacity (P < 0.05) compared with the control treatment. Furthermore, the APMS affected the fatty acid composition of the back fat by increasing linoleic acid (C18:2n6), linolenic acid (C18:3) and arachidic acid (C20:0) levels, while decreasing palmitic acid (C16:0), palmitoleic acid (C16:1) and heptadecenoic acid (C17:1) levels, compared with the control treatment. These results indicate that feeding fermented apple pomace to finishing pigs increases the feed efficiency and affects the meat quality and fatty acid composition of back fat.     

Effects of high dose of vitamin A on reproduction and egg quality of Japanese flounder Paralichthys olivaceus

ABSTRACT: The present study was conducted to investigate the effects of dietary vitamin A on reproduction and egg quality in Japanese flounder Paralichthys olivaceus . Broodstock were fed experimental pellets containing two levels of vitamin A [11 × 10³ IU/100 g (control diet; CD), 337 × 10³ IU/100 g (experimental diet; ED)] for approximately 2 months before spawning and during the spawning period. Two groups of five females (average weight 1.4 kg) and 10 males (average weight 0.7 kg) were randomly allocated to two 30 m³ indoor tanks. Total egg production of the CD group was slightly higher than the ED group. Percentage of buoyant eggs and hatching rate of the ED group were significantly higher than the CD. In other egg quality parameters, such as percentage abnormal larvae and starvation tolerance of larvae, no notable difference was found between these two groups. At the end of the experiment, the skin color of broodstock in the ED group was darker than that of the CD group. Vitamin A content in eggs of the ED group was significantly higher than that of the CD group. However, the difference in vitamin A content in eggs between the ED and CD groups was much smaller than that in the liver of the females between the two groups. These results indicate that feeding broodstock a higher level of vitamin A increases the vitamin A content in eggs but does not affect egg quality in Japanese flounder because excess dietary vitamin A was stored mainly in the broodstocks' liver.